Autoinflammatory diseases: a Latin American multicenter study according to age and sex / Doenças autoinflamatórias: um estudo multicêntrico latino-americano de acordo com o sexo e a idade

ABSTRACT Objective: To evaluate autoinflammatory diseases (AID) according to age at diagnosis and sex, and response to therapy in a large population. Methods: This is a cross-sectional observational study of a Latin American registry using a designed web system for data storage, collected between 2015 and 2018. Any altered findings during follow-up were recorded. The forms were translated into Portuguese and Spanish, including demographic, clinical, laboratory, genetic and treatment characteristics. Results: We included 152 patients, 51.3% male and 75% Caucasian. The median age at disease onset was 2.1 years (0-15.6 years) and median age at diagnosis 6.9 years (0-21.9 years); 111 (73%) were children (0-9 years old), and 41 (27%) were adolescents and young adults (AYA) (10-21 years old). Periodic fever, aphthous stomatitis, pharyngitis, and adenitis syndrome (PFAPA) occurred in 46/152 (30%), chronic non-bacterial osteomyelitis (CNO) in 32/152 (21%), and familial Mediterranean fever (FMF) in 24/152 (15.7%). PFAPA was significantly higher in young children than in AYA (38.7% vs. 7.3%, p<0.001), while CNO were lower (13.5% vs. 41.5%, p<0.001). The frequency of females was significantly higher in CNO (28.4% vs. 14.1%, p=0.031) and lower in FMF (8.1% vs. 23.1%, p=0.011). The most used drugs were glucocorticoids, non-steroidal anti-inflammatory drugs (NSAID), and colchicine. Glucocorticoids and colchicine treatment were used in all AID with good to moderate response. However, cryopyrin-associated periodic syndromes (CAPS) seemed unresponsive to glucocorticoids. NSAIDs and methotrexate were the main medications used to treat CNO. Conclusions: Differences among AID patients were observed in the LA population regarding sex and age at disease diagnosis.

RESUMO Objetivo: Avaliar as doenças autoinflamatórias (DAI) de acordo com sexo e idade no momento do diagnóstico e a resposta terapêutica em uma grande população. Métodos: Este é um estudo observacional transversal de um registro latino-americano que usou um sistema de dados coletados entre 2015 e 2018. Quaisquer achados alterados ao longo do acompanhamento foram registrados. Os formulários foram traduzidos para os idiomas português e espanhol, incluindo características demográficas, clínicas, laboratoriais, genéticas e de tratamento. Resultados: Incluímos 152 pacientes, sendo 51,3% do sexo masculino e 75% da raça branca. A média de idade de início da doença foi de 2,1 anos (0-15,6 anos) e a média de idade de diagnóstico 6,9 anos (0-21,9 anos); 111 (73%) eram crianças (0-9 anos) e 41 (27%) adolescentes/adultos jovens (10-21 anos). A síndrome de febre periódica, estomatite aftosa, faringite e adenite (PFAPA) ocorreu em 46/152 (30%), osteomielite não bacteriana crônica (CNO) em 32/152 (21%) e febre familiar do Mediterrâneo (FMF) em 24/152 (15,7%). A PFAPA foi significativamente maior em crianças pequenas (38,7 vs. 7,3%, p<0,001), e a CNO, em adolescentes/adultos jovens (13,5 vs. 41,5%, p<0,001). A frequência do sexo feminino foi significativamente maior na CNO (28,4 vs. 14,1%, p=0,031) e menor na FMF (8,1 vs. 23,1%, p=0,011). Os medicamentos mais utilizados foram glicocorticoides, anti-inflamatórios não esteroidais (AINE) e colchicina. O tratamento com glicocorticoides e colchicina foi usado em todas as DAI com resposta boa a moderada. No entanto, as síndromes periódicas associadas à criopirina (CAPS) pareciam não responder aos glicocorticoides. AINE e metotrexato foram os principais medicamentos utilizados no tratamento da CNO. Conclusões: Diferenças de pacientes com DAI foram observadas na população latino-americana em pacientes agrupados por sexo e idade ao diagnóstico da doença.

Screening program for familial hyperchylomicronemia syndrome detection: Experience of a university health system

ABSTRACT Objective: Familial chylomicronemia syndrome (FCS) is a rare autosomal recessive metabolic disorder caused by mutations related to chylomicron metabolism. The objective of this study is to show the development and results of a screening program for FCS in Argentina. Materials and methods: A cross-sectional study was performed. All patients > 18 years with a triglyceride level ≥ 1,000 mg/dL in the period from January 1, 2017 to December 31, 2021 were included. The program was developed in three stages: (1) Review of electronic records and identification of suspected laboratory cases (triglyceride level ≥ 1,000 mg/dL); (2) Identification of suspected clinical cases (all suspected laboratory cases that had no relevant secondary factors) and application of the FCS score to define probable cases (score ≥ 10); (3) Perform genetic tests in probable cases. Results: Globally, 348 suspected laboratory cases (mean age of 49.9 years, 77.3% men) were included. The median triglycerides level was 1,309 mg/dL (interquartile range 1,175-1,607 mg/dL). In total, 231 patients were categorized as suspected clinical cases. After applying the FCS score, 3% of them were classified as "very likely FCS" (probable cases). Four variants of uncertain significance have been identified. No previously reported pathogenic variants were detected. Conclusion: This study shows a screening program for the detection of FCS. Although no patient was diagnosed with FCS, we believe that more programs of these characteristics should be developed in our region, given the importance of early detection of this metabolic disorder.

Indirect costs associated with "free" paediatric haemodialysis: Experience from Karachi, Pakistan

Treatment of children with end-stage kidney disease (ESKD), requiring maintenance dialysis, poses unique challenges. In low- and middle-income countries, lifelong treatment leads to significant stress on the overall family unit. Families face serious financial, social and psychological consequences despite free treatment. This pilot study, utilising primarily quantitative methods, supplemented by two case studies, is set in Sindh Institute of Urology and Transplantation, a tertiary care hospital in Karachi, Pakistan, providing free medical treatment. Fifty-two caretakers of children receiving haemodialysis for more than five years participated in the quantitative arm. Findings reveal that additional financial challenges may send the entire household into financial catastrophe. Social problems include migration from native cities, impact on the education of the sick child along with changes in lives of siblings. One-third of primary caretakers screened positive for anxiety/depression. Healthcare professionals 'practising' in developing countries face considerable ethical dilemmas in their practice when offering “free” paediatric dialysis services knowing the financial and psychological burden imposed on families.

Brazilian consensus for diagnosis, management and treatment of hereditary transthyretin amyloidosis with peripheral neuropathy: second edition / Consenso brasileiro para o diagnóstico, manejo e tratamento da polineuropatia amiloidótica familiar associada à transtirretina: segunda edição

Abstract Hereditary transthyretin amyloidosis with peripheral neuropathy (ATTRv-PN) is an autosomal dominant inherited sensorimotor and autonomic polyneuropathy with over 130 pathogenic variants identified in the TTR gene. Hereditary transthyretin amyloidosis with peripheral neuropathy is a disabling, progressive and life-threatening genetic condition that leads to death in ~ 10 years if untreated. The prospects for ATTRv-PN have changed in the last decades, as it has become a treatable neuropathy. In addition to liver transplantation, initiated in 1990, there are now at least 3 drugs approved in many countries, including Brazil, and many more are being developed. The first Brazilian consensus on ATTRv-PN was held in the city of Fortaleza, Brazil, in June 2017. Given the new advances in the area over the last 5 years, the Peripheral Neuropathy Scientific Department of the Brazilian Academy of Neurology organized a second edition of the consensus. Each panelist was responsible for reviewing the literature and updating a section of the previous paper. Thereafter, the 18 panelists got together virtually after careful review of the draft, discussed each section of the text, and reached a consensus for the final version of the manuscript.

Resumo Polineuropatia amiloidótica familiar associada a transtirretina (ATTRv-PN) é uma polineuropatia sensitivo-motora e autonômica hereditária autossômica dominante com mais de 130 variantes patogênicas já identificadas no gene TTR. A ATTRv-PN é uma condição genética debilitante, progressiva e que ameaça a vida, levando à morte em ~ 10 anos se não for tratada. Nas últimas décadas, a ATTRv-PN se tornou uma neuropatia tratável. Além do transplante de fígado, iniciado em 1990, temos agora 3 medicamentos modificadores de doença aprovados em muitos países, incluindo o Brasil, e muitas outras medicações estão em desenvolvimento. O primeiro consenso brasileiro em ATTRv-PN foi realizado em Fortaleza em junho de 2017. Devido aos novos avanços nesta área nos últimos 5 anos, o Departamento Científico de Neuropatias Periféricas da Academia Brasileira de Neurologia organizou uma segunda edição do consenso. Cada panelista ficou responsável por rever a literatura e atualizar uma parte do manuscrito. Finalmente, os 18 panelistas se reuniram virtualmente após revisão da primeira versão, discutiram cada parte do artigo e chegaram a um consenso sobre a versão final do manuscrito.

Very low HDL levels: clinical assessment and management

ABSTRACT In individuals with very low high-density lipoprotein (HDL-C) cholesterol, such as Tangier disease, LCAT deficiency, and familial hypoalphalipoproteinemia, there is an increased risk of premature atherosclerosis. However, analyzes based on comparisons of populations with small variations in HDL-C mediated by polygenic alterations do not confirm these findings, suggesting that there is an indirect association or heterogeneity in the pathophysiological mechanisms related to the reduction of HDL-C. Trials that evaluated some of the HDL functions demonstrate a more robust degree of association between the HDL system and atherosclerotic risk, but as they were not designed to modify lipoprotein functionality, there is insufficient data to establish a causal relationship. We currently have randomized clinical trials of therapies that increase HDL-C concentration by various mechanisms, and this HDL-C elevation has not independently demonstrated a reduction in the risk of cardiovascular events. Therefore, this evidence shows that (a) measuring HDL-C as a way of estimating HDL-related atheroprotective system function is insufficient and (b) we still do not know how to increase cardiovascular protection with therapies aimed at modifying HDL metabolism. This leads us to a greater effort to understand the mechanisms of molecular action and cellular interaction of HDL, completely abandoning the traditional view focused on the plasma concentration of HDL-C. In this review, we will detail this new understanding and the new horizon for using the HDL system to mitigate residual atherosclerotic risk.

Mechanisms of PiT2-loop7 Missense Mutations Induced Pi Dyshomeostasis / 神经科学通报·英文版

PiT2 is an inorganic phosphate (Pi) transporter whose mutations are linked to primary familial brain calcification (PFBC). PiT2 mainly consists of two ProDom (PD) domains and a large intracellular loop region (loop7). The PD domains are crucial for the Pi transport, but the role of PiT2-loop7 remains unclear. In PFBC patients, mutations in PiT2-loop7 are mainly nonsense or frameshift mutations that probably cause PFBC due to C-PD1131 deletion. To date, six missense mutations have been identified in PiT2-loop7; however, the mechanisms by which these mutations cause PFBC are poorly understood. Here, we found that the p.T390A and p.S434W mutations in PiT2-loop7 decreased the Pi transport activity and cell surface levels of PiT2. Furthermore, we showed that these two mutations attenuated its membrane localization by affecting adenosine monophosphate-activated protein kinase (AMPK)- or protein kinase B (AKT)-mediated PiT2 phosphorylation. In contrast, the p.S121C and p.S601W mutations in the PD domains did not affect PiT2 phosphorylation but rather impaired its substrate-binding abilities. These results suggested that missense mutations in PiT2-loop7 can cause Pi dyshomeostasis by affecting the phosphorylation-regulated cell-surface localization of PiT2. This study helps understand the pathogenesis of PFBC caused by PiT2-loop7 missense mutations and indicates that increasing the phosphorylation levels of PiT2-loop7 could be a promising strategy for developing PFBC therapies.

Advances in diagnosis and treatment of familial hypercholesterolemia / 南方医科大学学报

Familial hypercholesterolemia (FH) is an autosomal dominant inherited disease caused by abnormal lipoprotein metabolism. Patients with FH have a significantly increased risk of coronary artery disease (CAD) due to long-term exposure to high levels of low-density lipoprotein (LDL). The diagnosis of FH relies heavily on gene detection, and examination of LDL receptor (LDLR) function is of great significance in its treatment. This review summarizes the current advances in the screening, diagnosis, and treatment of FH and functional analysis of LDLR gene mutations.

Efficacy of scleral buckling for retinal detachment secondary to familial exudative vitreoretinopathy / 中华实验眼科杂志

Objective:To evaluate the efficacy of scleral buckling in the treatment of retinal detachment (RD) secondary to familial exudative vitreoretinopathy (FEVR).Methods:An observational case series study was conducted.A total of 37 patients (42 eyes) of RD secondary to FEVR who were treated with scleral buckling in Beijing Tongren Hospital from July 2010 to March 2021 were enrolled.There were 30 males (35 eyes) and 7 females (7 eyes), with an average age of (15.21±5.42) years old.Scleral buckling under general anesthesia was performed in all patients.There were 22 eyes with rhegmatogenous RD (RRD), of which 21 eyes were treated with local external compression combined with cerclage, and 1 eye was treated with radial spinal compression.There were 13 eyes with tractive RD (TRD), of which 12 eyes were treated with local external compression combined with cerclage and subretinal fluid drainage, and 1 eye was treated with scleral buckling combined with vitrectomy.There were 7 eyes with RRD combined with TRD, of which 4 eyes were treated with local external compression combined with cerclage and subretinal fluid drainage, and 3 eyes were treated with scleral buckling combined with vitrectomy.The average follow-up time was (30.61±10.50) months.The main outcomes were best corrected visual acuity (BCVA) of the operated eye converted to the logarithm of the minimum angle of resolution, retinal reattachment rate, and incidence of complications.The study adhered to the Declaration of Helsinki and was approved by the Ethics Committee of Beijing Tongren Hospital, Capital Medical University (No.TRECKY2018-056-GZ[2022]-07). Written informed consent was obtained from each subject or their guardians before entering the cohort.Results:The average BCVA was 0.83±0.50 at last follow-up after surgery which was better than 1.10±0.39 before surgery, and the difference was statistically significant ( t=6.639, P<0.001). There were 39 eyes with retinal reattachment and 3 eyes without retinal reattachment.The reattachment rate was 95.45%(21/22) in RRD, 84.62%(11/13) in TRD, and 100%(7/7) in RRD combined with TRD.No serious complication occurred in any patients during postoperative follow-up. Conclusions:On the premise of optimized surgical strategy based on the indications of RD secondary to FEVR, scleral buckling has a high retinal reattachment rate in the treatment of RD secondary to FEVR.

Familial glucocorticoid deficiency caused by the NNT gene mutation: a case report and literature review / 中华实用儿科临床杂志

The clinical data, diagnose and treatment of a child with familial glucocorticoid deficiency (FGD) caused by the NNT gene mutation who was treated in the Department of Endocrinology, Children′s Hospital Affiliated to Nanjing Medical University in November 2014 were retrospectively analyzed.The female child with 1 year and 5 months old presented with 6 months of skin pigmentation.Laboratory examinations showed decreased cortisol and increased adrenocorticotropic hormone.During the follow-up period, she developed convulsions and precocious puberty.Whole exome sequencing revealed that the patient carried a homozygous mutation c. 1054G > A (p.G352R) in exon 8 of the NNT gene, which was a newly reported gene mutation.Domestic cases of FGD caused by the NNT gene mutation has never been reported yet.Through literature review of a total of 40 reported children with FGD caused by the NNT gene mutation, typical manifestations included skin pigmentation, hypoglycemia and seizures, alongside mineralocorticoid deficiency, precious puberty, abnormal male gonadal development, thyroid diseases and heart diseases.

Phenotype and genotype analysis of progressive familial intrahepatic cholestasis type 4 / 中华实用儿科临床杂志

Objective:To improve the understanding of progressive familial intrahepatic cholestasis type 4 (PFIC4).Methods:Clinical characteristics in a 10-year-old boy with PFIC4 at the Second Hospital of Hebei Medical University in February 2020 were retrospectively analyzed, and the TJP2 gene mutations were analyzed. Results:The proband was a 10-year-old boy with a slow onset of intrahepatic cholestasis[normal γ-glutamyl transpeptidase(GGT)], hepatosplenomegaly and hepatic fibrosis.Laboratory tests showed elevated levels of total bilirubin, especially the direct bilirubin increased.Alanine aminotransferase, aspartate transaminase acid and total bile acid were elevated, while GGT remained in a normal range.Oral medication of ursodeoxycholic acid initially improved liver biochemical parameters, but later fluctuated.Adenosine dehydrogenase, coagulation indicators and hepatic fibrosis indexes were persistently abnormal.The average shear wave velocity of liver was 1.9 times of the upper limit of normal value.Compound heterozygous mutations c. 334G>A(p.A112T)/c.580_639delGACCGGAGCCGTGGCCGGAGCCTGGAGCGGGG-CCTGGACCAAGACCATGCGCGCACCCGA (p.194_213delDRSRGRSLERGLDQDHARTR) were found in the TJP2 gene.The deletion mutation of the TJP2 gene was reported for the first time throughout the world.Both of his parents carried a heterozygous mutation. Conclusions:PFIC should be considered in intrahepatic cholestasis patients with a normal range of GGT.The detection of TJP2 gene mutation is of great value in the clinical diagnosis of PFIC4.The presence of TJP2 gene mutation may be a risk factor for patient developing cirrhosis of liver and primary liver cancer in early childhood.It is necessary for children with PFIC4 to be closely followed up.

The Pathology of Primary Familial Brain Calcification: Implications for Treatment / 神经科学通报·英文版

Primary familial brain calcification (PFBC) is an inherited neurodegenerative disorder mainly characterized by progressive calcium deposition bilaterally in the brain, accompanied by various symptoms, such as dystonia, ataxia, parkinsonism, dementia, depression, headaches, and epilepsy. Currently, the etiology of PFBC is largely unknown, and no specific prevention or treatment is available. During the past 10 years, six causative genes (SLC20A2, PDGFRB, PDGFB, XPR1, MYORG, and JAM2) have been identified in PFBC. In this review, considering mechanistic studies of these genes at the cellular level and in animals, we summarize the pathogenesis and potential preventive and therapeutic strategies for PFBC patients. Our systematic analysis suggests a classification for PFBC genetic etiology based on several characteristics, provides a summary of the known composition of brain calcification, and identifies some potential therapeutic targets for PFBC.

Familial chylomicronemia syndrome: A comprehensive clinical and genetic approach

Abstract The familial chylomicronemia syndrome (FCS) is characterized by very high levels of circulating triglycerides. FCS is caused by lipoprotein lipase (LPL) deficiency resulting from homozygous or biallelic loss-of-function variants in the LPL or other related genes. Here, we report a case of severe hypertriglyceridemia refractory to conventional therapy in a male patient diagnosed at 33 years of age. LPL activity was below 20%. During the clinical course, the patient developed severe acute pancreatitis in addition to other complications. Two heterozygous variants (c.984G>A and c.1139+6T>C) which had not been previously reported in the major databases were identified in the LPL gene. Treatment with volanesorsen was proposed based on its approved indication as an adjunct to diet in adult patients with confirmed FCS and at high risk for pancreatitis. Volanesorsen was effective and well-tolerated, and the patient did not experience abdominal pain or any other manifestations. The assessment of genetic characterization is essential to guide treatment decisions during follow-up, in addition to the patient's history, their comorbidities and clinical stigmas.

Intra-abdominal desmoid tumors in familial adenomatous polyposis: How much do clinical and surgical variables interfere with their development?

Abstract Objective: Familial Adenomatous Polyposis is a complex hereditary disease that exposes the carrier to a great risk of Colorectal Cancer (CRC). After prophylactic surgery, intra-abdominal desmoid tumors are known to be one the most important cause of death. Therefore, recognition of increased-risk patients and modification of operative strategy may be crucial. Aim: The objective of this study was to estimate the desmoid tumor risk in relation to various surgical and clinical variables. Methods: Patients who had undergone polyposis since 1958 were included in the study. After exclusion criteria were met, those who had developed desmoid tumors were selected to undergo further evaluation. Results: The study revealed that the risk of developing desmoid tumors was associated with various factors such as sex ratio, colectomy, and reoperations. On the other hand, the type of surgery, family history, and surgical approach did not affect the risk of developing desmoid tumors. The data collected from 146 polyposis patients revealed that 16% had desmoid polyps. The sex ratio was 7:1, and the median age at colectomy was 28.6 years. Family history, multiple abdominal operations, and reoperations were some of the characteristics that were common in desmoid patients. Conclusion: Recognition of clinical (female sex) and surgical (timing of surgery and previous reoperations) data as unfavorable variables associated with greater risk may be useful during the decision-making process.

Analysis of family mutation type and two-hit hypothesis of a familial VHL Syndrome patient / 现代泌尿外科杂志

【Objective】 To explore the mutation type, clinical characteristics, molecular genetics and the two-hit type of a patient with familial Von Hippel Lindau (VHL) syndrome. 【Methods】 The data of the patient were collected. DNA was extracted from the peripheral blood and renal cell carcinoma sample. The VHL gene germline mutation site was detected with high throughput sequencing next generation sequencing (NGS). The two-hit site was identified with UCSCXena database, methylation-specific PCR (MSP) and microsatellite stability detection. 【Results】 The mutation site of the embryo line was located in c.500G>A R167Q mutation. The patient had single nucleotide polymorphism, but no clear loss of heterozygosity, methylation or system mutation. 【Conclusion】 The germline mutation in exon 3 is the basis for the clinical features of this familial renal cell carcinoma proband. The identification of the two-hit site is key to the occurrence of the disease, which is significant for the diagnosis and treatment. The use of the databases can guide the screening of mutations and methylation sites in familial renal cell carcinoma.

An Early Onset of Myocardial Infarction Patient with Syphilis and Familial Hypercholesterolemia / 罕见病研究

Syphilis may affect the cardiovascular system, in which coronary arteries are less commonly involved. Familial hypercholesterolemia (FH) is an autosomal dominant inherited disease with elevated low-density lipoprotein-cholesterol (LDL-C) levels due to impaired LDL-C clearance. We report a young male patient with syphilis and FH. The clinical manifestations were acute myocardial infarction and high LDL-C levels. Coronary angiography and intracoronary imaging showed multiple aneurysmal ectasia and stenosis. A drug-eluting stent was implemented when recurrent restenosis occurred after two percutaneous coronary drug-eluting balloon angioplasties.

Familial Hypercholesterolemia / 罕见病研究

Familial hypercholesterolemia (FH) is a group of autosomal co-dominant genetic diseases mainly characterized by abnormal low-density lipoprotein related metabolism. It is one of the most common inherited diseases in children and one of the most serious lipid metabolism diseases which results in various life-threatening cardiovascular diseases and the complications. In recent years, the treatment protocols for FH have diversified thanks to the deeper understanding of the disease in China and abroad and the development of new lipid-lowering drugs. However, the current awareness and diagnosis rate of FH are very low. The treatment of the disease is much inadequate. This paper summarizes the clinical characteristics, diagnosis, screening strategy, and treatment of FH hoping to enhance the understanding and awareness of the disease in the society.

A Case Report of Homozygous Familial Hypercholesterolemia Liver Transplantation / 罕见病研究

Homozygous familial hypercholesterolemia (HoFH) is a rare and serious autosomal genetic metabolic disease. Patients without intervention often die younger than 30 years old from early atherosclerotic cardiovascular disease (ASCVD)incurred by extremely high levels of low-density lipoprotein cholesterol (LDL-C). We present a case of HoFH, a child with compound heterozygous mutation in this study. The effect of conventional lipid-lowering therapy through diet control and lipid-lowering drugs was unsatisfactory. The blood-lipid purification proves effective but has poor compliance and difficult to maintain for a longer time. The patient received orthotopic liver transplantation and had been followed for 2 years, with the patient shows normal LDL-C, well growth and development. We hope the case will provide the clinician with better understanding of the diagnosis and treatment of the rare disease of HoFH.

Research progresses on pathogenic genes and related signal pathways of familial exudative vitreoretinopathy / 中华眼底病杂志

Familial exudative vitreoretinopathy (FEVR) is a serious hereditary retinal vascular disease. The clinical manifestations vary, and the severity of the patients' condition is different. In severe cases, it may lead to bilateral blindness. The pathogenic mechanism of FEVR is also complex. At present, more than ten classical and candidate pathogenic genes have been found: NDP, FZD4, LRP5, TSPAN12, CTNNB1, KIF11, ZNF408, RCBTB1, LRP6, CTNNA1, CTNND1, JAG1, ATOH7, DLG1, DOCK6, ARHGP31 and EVR3 region. These pathogenic genes are involved in Wnt/β-catenin signaling pathway, norrin/β-catenin pathway and Notch pathway. They regulate and affect the development of retinal blood vessels, hyaloid vascular system regression, endothelial cell connections, and blood retinal barrier homeostasis, ultimately leading to the occurrence and development of FEVR disease.